RegulonDB RegulonDB 11.0: Gene Sequence
rpnD gene sequence


Size: 921        A: 237  T: 234  G: 235  C: 215

Fasta

 

>rpnD E. coli K12. Version NC_000913.3 GI:556503834
atgacaaacttcacgaccagcacgccgcatgatgcattatttaaaacctttctcacgcac
cctgacactgcgcgggattttatggagattcacttacctaaagatttacgtgaactgtgc
gatctcgatagcttaaaactggaatccgccagctttgtcgatgaaaaattgcgggcgcta
cactccgatattttatggtcggtaaagacccgcgaaggcgatggctatatctatgtggtg
attgaacatcagagccgcgaggacattcatatggcctttcgcctgatgcgctattccatg
gcggtgatgtagcgccatatagagcatgataaacgccagccgctaccgttggtcatcccg
atgctattttatcacggtagccgtagtccttacccctggtccctgtgctggctggacgaa
tttgccgacccgactaccgcacggaagctttataacgccgcgttcccgctggtggatgtt
actgtcgtgccagacgacgagattgtgcagcatcgcagagtcgccctgttggagttgatc
caaaagcatattcgccagcgcgatctgatggggcttatcgatcaactggtagtattactg
gttacagagtgtgctaatgacagccagataactgcgctgttaaattacattttactgact
ggcgatgaagcgcgttttaatgagtttatcagtgaacttacccgtcgaatgccacaacac
agggagcgaataatgacgattgcagagcgaattcataatgatggatatataaaaggggag
cagcgcattcttcgattgttgttgcagaatggggcggatcctgaatggatacaaaagatt
accggactttcggcagagcaaatgcaggcattaaggcagcccttgcctgagcgtgagcgc
tattcatggctcaagagctaa
              
                            

Download fasta file
RegulonDB