RegulonDB RegulonDB 11.0: Gene Sequence
yjiR gene sequence


Size: 1413        A: 315  T: 320  G: 416  C: 362

Fasta

 

>yjiR E. coli K12. Version NC_000913.3 GI:556503834
atgacgcgttatcaacatctggcgactctgcttgccgaacggattgagcaagggctgtat
cgtcacggggagaaattgccgtcggtgcgcagcttaagtcaggagcacggcgtcagtatc
agcaccgtgcagcaggcgtatcagacgctggagacgatgaagctcatcactccgcagccg
cgttcgggttattttgtcgcacaacgtaaagcccagccgccagtaccgccgatgacgcgt
ccggtgcagcgcccggtggaaattacccagtgggatcaggtgctggatatgctggaggcg
catagcgacagttccattgttccgttaagcaaaagcacaccggatgtcgaagcgcccagc
ctgaaaccgctgtggcgggagctaagccgggtggtgcagcataatctgcaaaccgttctc
ggttatgacttgttagccggtcagcgagtattgcgagagcagattgcccgcctgatgctc
gacagcggctcggtggtcaccgccgatgacatcatcatcaccagcggctgccataactcg
atgtcgctggcgttaatggcagtgtgtaaaccgggcgatattgtcgcggtcgaatccccc
tgttattacggttcgatgcagatgctgcgcggcatgggcgtgaaagtgattgaaatccca
accgatccagaaactggcatcagcgttgaagcgctggaactggcgctggaacagtggccg
attaaaggcatcattctggtgccaaactgtaataatccgctgggatttattatgccggac
gcgcgcaaacgggccgttctctctctcgctcagcgtcatgatattgtgatttttgaagat
gatgtctatggcgaactggcgacggagtatccgcgcccgcggaccattcattcctgggat
atcgacgggcgagtgctgttgtgcagctcgttcagtaaaagtattgcaccaggcctgcgc
gtgggttgggtcgcaccggggcgttatcacgataaactgatgcatatgaaatacgccatc
agcagctttaatgtgccgtccacgcaaatggcggcggcaacgtttgtgctggaaggtcac
tatcatcgccatatccggcggatgcggcagatctatcagcgcaatttggcgctttatacc
tgctggatacgggaatattttccctgcgaaatctgtattacgcgcccgaaaggcggattt
ttactgtggatagaattgcctgaacaggtcgatatggtctgcgtcgcgcggcagctgtgc
cgcatgaaaatccaggtggcggcaggctcgattttctcagcttccggcaaataccgtaat
tgtctgcgcatcaactgcgctttgccgctcagcgaaacctatcgcgaagcactgaagcaa
attggcgaggccgtgtatcgggcaatggaataa
              
                            

Download fasta file
RegulonDB