RegulonDB RegulonDB 11.0: Gene Sequence
yjiS gene sequence


Size: 165        A: 41  T: 32  G: 61  C: 31

Fasta

 

>yjiS E. coli K12. Version NC_000913.3 GI:556503834
atggaatttcacgaaaacagagctaaagcgccgtttatcggcctggtgcaactctggcag
gcggtgaggcgttggcggcggcaaatgcagacccgacgcgtgttacagcagatgagtgat
gagcggttgaaggatatcgggttacgcagggaggatgtggagtga
              
                            

Download fasta file
RegulonDB