RegulonDB RegulonDB 11.0: Gene Sequence
yjiT gene sequence


Size: 1518        A: 427  T: 416  G: 364  C: 311

Fasta

 

>yjiT E. coli K12. Version NC_000913.3 GI:556503834
ttgggtcaatcagaatacatttcatgggtaaaatgtacttcctggctaagtaactttgtg
aatcttagagggttgagacaaccggatggccgtcctctttatgaatatcatgcaaccaat
gatgaatatacccaattaacgcagctactccgtgcagtcggtcaatcacaatctaatata
tgtaatagggactttgctgcctgttttgttcttttttgctctgagtggtaccgcagggat
tatgaacggcaatgcggatggacgtgggaccctatatataaaaaaatagggatttcattc
accgccacagagcttggtactatcgtaccgaaagggatggaagattactggctgcgccca
attcgattttatgaatctgaacgacgcaattttctcggaacattattcagtgaaggtggt
ttacctttccggctactcaaagaatcagacagtcgctttctggctgttttctccaggatc
cttggacaatatgagcaagcaaagcagtcaggtttttctgccctttcgctggcaagagct
gtcatagaaaaatcagcgctgccaactgtttttagcgaagatacctctgtagaacttatc
agtcatatggctgataacctcaattccttagtacttactcacaacctaataaatcacaaa
gaaccagtacaacagcttgagaaggttcaccctacctggcgaagcgagtttccaataccg
ttagatgatgaaacaggaacgcattttttgaatggactgctatgcgcagcctctgtagag
gctaagcctcgactacaaaaaaataagagtacgcgttgccaattctattggtcagaaaag
catccagatgagcttagggtgatagtatctcttccggacgaagtttcctttcctgtaaca
agcgagccgtcaactacgcgctttgaacttgccatttgtgaagatggtgaggaagtctct
ggccttgggccagcctatgcttctctggaaaacagacaggcaacagttcgattacgtaaa
agcgaagtgagatttggcaggcaaaatccatcggcaggtttgtcgttagtggctcgtgct
ggagggatgattgttgggagcattaaacttgatgacagtgaaattgccattggtgaggtg
ccgttaaccttcatcgttgatgcagatcaatggctgttacagggacaggcttcttgcagt
gtgcgaagcagcgatgttctgattgtgctccctcgggataatagcaatgttgctggtttt
gatggccaatcgagggcagtaaacgtattaggactaaaagcactacctgtgaagggatgt
caggacgttacagttacagcaaatgaaacttatcggattcgcaccggaagagaacaaatc
agcatcggaaggtttgctctaaatggaaagcgtgcaagctgggtttgtcatccagatgaa
acatttattggtgtaccaaaagtcatttctacactaccggatattcaaagcattgatgta
acgcgttacacgtgctga
              
                            

Download fasta file
RegulonDB