RegulonDB RegulonDB 10.9: Gene Sequence
symE gene sequence


Size: 342        A: 84  T: 68  G: 95  C: 95

Fasta

 

>symE E. coli K12. Version NC_000913.3 GI:556503834
atgactgacacgcattctattgcacaaccgttcgaagcagaagtctccccggcaaataac
cgtcatgtcaccgtcggttatgcgagtcgctacccggattacagccgtattcccgccatc
accctgaaaggtcagtggctggaagccgccggttttgccactggcacggcggtagatgtc
aaagtgatggaaggctgtattgtcctcaccgcccaaccacccgccgccgaggagagcgaa
ctgatgcagtcgctacgccaggtgtgcaaactgtcggcgcgtaaacaaaagcaggtgcag
gcgtttattggagtgattgccggtaaacagaaagtcgcgtaa
              
                            

Download fasta file
RegulonDB