RegulonDB RegulonDB 10.9: Gene Sequence
lgoR gene sequence


Size: 915        A: 240  T: 241  G: 195  C: 239

Fasta

 

>lgoR E. coli K12. Version NC_000913.3 GI:556503834
atgagtcgttcacaaaatttacgccacaatgtgattaaccaggtcattgatgatatggcg
cggggtcatatcccttccccacttccatcgcaaagtgcgctggcggaaatgtacaacatc
agccgcaccacagtgcgtcatattctcagccacttacgcgaatgcggcgtcttgacgcag
gttggaaacgactatgttattgcgcgtaaacctgaccatgatgacggtttcgcctgtact
accgcttcaatgagtgaacaaaacaaagtgtttgagcaggcttttttcacgatgataaac
cagcgccagttacgcccaggggaaacgttttctgaactgcaactggctcgggccgcgggt
gtcagcccggttgtagtaagagaatatcttttaaaattcggccgttataatcttattcac
agcgaaaagcgcggccagtggagcatgaagcaattcgatcaatcctacgccgagcagctg
tttgagctacgcgaaatgctcgaaacacattcacttcagcactttctcaacctgcctgat
catgatccccgctggctgcaggcgaaaaccatgctcgaacgtcatcggctactgcgtgac
aacatcggcaatagctttcgcatgttctcgcaacttgacagagattttcactccttactg
ctttcagctgccgacaatatcttttttgatcaatcgcttgagatcatctcagtcatcttt
cattttcactatcaatgggacgaaagcgatcttaaacagcgcaatatcattgccgtcgat
gagcatatgaccattctcagcgctctgatttgccgcagtgaccttgatgccacccttgcg
ctccgtaaccatttgaattcagctaaacaatcaatgattcgatccattaatgagaacacg
cgttatgctcattaa
              
                            

Download fasta file
RegulonDB