RegulonDB RegulonDB 10.9: Gene Sequence
yjjU gene sequence


Size: 1074        A: 237  T: 258  G: 303  C: 276

Fasta

 

>yjjU E. coli K12. Version NC_000913.3 GI:556503834
gtggggcagcgaatacctgtaacgcttggtaatattgcgccgttgtcgctaaggccgttc
cagcctggacgaatagctctggtgtgcgaaggcggcggacagcgtggaattttcacggct
ggcgtgctggatgagtttatgcgcgcgcagtttaatcctttcgatctttatctcggcaca
tctgccggggcgcagaacctctcggcgtttatctgcaatcagcccggttacgcgcgcaaa
gtcatcatgcgctataccacaaaacgcgaatttttcgatccattgcgctttgtccgtgga
ggaaatcttatcgatctcgactggctggtggaggccactgcaagccagatgccgttgcaa
atggataccgccgcgcggttgtttgacagcggcaaatcgttttatatgtgcgcctgtcgt
caggatgactacgcgccgaattactttttaccaaccaaacaaaactggctggatgtgatt
cgcgcctccagtgcgatacctggcttttatcgtagcggagtgtcgctggaaggcattaac
tacctggatggcgggatcagtgatgcgattccggttaaagaggcggcaaggcagggcgct
aaaacgttggtcgtcattcgcactgtgccgtcacaaatgtactacacgccgcagtggttc
aaacgcatggaacgctggctgggtgacagtagcctgcagccgctggtcaatctggtgcag
catcatgaaaccagctatcgtgacattcagcaatttattgagaaaccaccgggcaagctg
cggatattcgaaatttatccgccgaagccattacatagtatcgcgcttggcagtcggatt
ccggcgctgcgtgaagactataaacttgggcgtttatgcggtcgttatttcctcgccacg
gttggcaagctattaactgaaaaagcgccgcttacccgccatctggtgccagtggtgacg
ccggaatcgattgtcattccgcctgcgccagtcgccaacgatacgctggttgccgaagtg
agcgacgctccgcaggcgaacgacccgacatttaacaatgaggatctggcttga
              
                            

Download fasta file
RegulonDB