RegulonDB RegulonDB 10.10: Gene Sequence
yjjW gene sequence


Size: 864        A: 184  T: 193  G: 276  C: 211

Fasta

 

>yjjW E. coli K12. Version NC_000913.3 GI:556503834
atgaacagcagatgcgctttagtcagtaagattatccccttctcctgcgttgacgggcca
ggcagtcgtctggctctgtttttgcagggctgcaatctgcgctgcaaaaactgtcacaat
ccgtggacgatgggacgttgcaatgactgtggggagtgcgtgccacagtgtccgcatcag
gcgttgcagattgttgacggcaaagtggtgtggaacgctgtggtttgcgagcagtgtgat
acctgcctgaagaggtgtccgcaacatgccacgcccatggcgcaatccatgagcgtggac
gaagtgcttagccatgtccgcaaagcagtgctgtttatcgaagggataacggtgagtggc
ggtgaagccacgacccagctgccgtttgtggtggcgctgtttactgctatcaaaaacgat
ccgcaactgcgccatctcacctgtctggtggacagtaacggcatgttgagcgaaaccggc
tgggaaaaattgctcccggtgtgcgacggcgcaatgctcgatctcaaagcgtgggggagc
gaatgtcatcaacaactcaccggacgcgataatcagcagattaagcgcagcatctatttg
ctggcagagcgcggcaagctggcggaactgcgtttgctggtgatccctggccaggtggat
tatttgcaacacatcgaagaactggcggcgtttatcaagggactcggcgatgttccggta
cgcctgaacgcgtttcatgcccacggcgtgtatggcgaggcgcaaagctgggcgagcgcc
acgccggaagacgttgagccgttggctgatgcgttaaaggtgcgcggggtgagccggttg
atatttccggcgctctatttgtga
              
                            

Download fasta file
RegulonDB