RegulonDB RegulonDB 10.9: Gene Sequence
feaB gene sequence


Size: 1500        A: 342  T: 357  G: 458  C: 343

Fasta

 

>feaB E. coli K12. Version NC_000913.3 GI:556503834
atgacagagccgcatgtagcagtattaagccaggtccaacagtttctcgatcgtcaacac
ggtctttatattgatggtcgtcctggccccgcacaaagtgaaaaacggttggcgatcttt
gatccggccaccgggcaagaaattgcgtctactgctgatgccaacgaagcggatgtagat
aacgcagtcatgtctgcctggcgggcctttgtctcgcgtcgctgggccgggcgattaccc
gcagagcgtgaacgtattctgctacgttttgctgatctggtggagcagcacagtgaggag
ctggcgcaactggaaaccctggagcaaggcaagtcaattgccatttcccgtgcttttgaa
gtgggctgtacgctgaactggatgcgttataccgccgggttaacgaccaaaatcgcgggt
aaaacgctggacttgtcgattcccttaccccagggggcgcgttatcaggcctggacgcgt
aaagagccggttggcgtagtggcgggaattgtgccatggaactttccgttgatgattggt
atgtggaaggtgatgccagcactggcagcaggctgttcaatcgtgattaagccttcggaa
accacgccactgacgatgttgcgcgtggcggaactggccagcgaggctggtatccctgat
ggcgtttttaatgtcgtcaccgggtcaggtgctgtatgcggcgcggccctgacgtcacat
cctcatgttgcgaaaatcagttttaccggttcaaccgcgacgggaaaaggtattgccaga
actgctgctgatcacttaacgcgtgtaacgctggaactgggcggtaaaaacccggcaatt
gtattaaaagatgctgatccgcaatgggttattgaaggcttgatgaccggaagcttcctg
aatcaagggcaagtatgcgccgccagttcgcgaatttatattgaagcgccgttgtttgac
acgctggttagtggatttgagcaggcggtaaaatcgttgcaagtgggaccggggatgtca
cctgttgcacagattaaccctttggtttctcgtgcgcactgcgacaaagtgtgttcattc
ctcgacgatgcgcaggcacagcaagcagagctgattcgcgggtcgaatggaccagccgga
gaggggtattatgttgcgccaacgctggtggtaaatcccgatgctaaattgcgcttaact
cgtgaagaggtgtttggtccggtggtaaacctggtgcgagtagcggatggagaagaggcg
ttacaactggcaaacgacacggaatatggcttaactgccagtgtctggacgcaaaatctc
tcccaggctctggaatatagcgatcgcttacaggcagggacggtgtgggtaaacagccat
accttaattgacgctaacttaccgtttggtgggatgaagcagtcaggaacgggccgtgat
tttggccccgactggctggacggttggtgtgaaactaagtcggtgtgtgtacggtattaa
              
                            

Download fasta file
RegulonDB