RegulonDB RegulonDB 11.1: Gene Sequence
uxaC gene sequence


Size: 1413        A: 337  T: 309  G: 385  C: 382

Fasta

 

>uxaC E. coli K12. Version NC_000913.3 GI:556503834
atgactccgtttatgactgaagatttcctgttagataccgaatttgcccgccgtctgtat
cacgactacgcaaaagaccagccgattttcgattaccattgccatttgccgccgcagcag
attgcggaagactatcgttttaaaaacctgtatgacatctggctgaaaggcgatcactac
aaatggcgcgctatgcgtaccaacggtgtggccgagcgtctgtgtaccggtgatgcgtct
gaccgtgaaaaatttgacgcctgggcggcgactgttccgcacactatcggcaacccgtta
taccactggacgcacctcgaactgcgccgtccgtttggtatcactggcaaattgctttct
ccgtcaactgccgatgaaatctggaacgaatgtaacgaactgctggcgcaggataacttc
tccgcgcgcggcatcatgcagcagatgaacgtgaaaatggtcggcaccaccgatgacccg
atcgattctctggagcatcacgcagagatcgccaaagacggctctttcaccatcaaagtg
ctgccgagctggcgtccggacaaagccttcaacatcgaacaggcgacctttaacgactac
atggcgaagctgggcgaagtttccgataccgacattcgccgctttgctgacctgcaaact
gccctgaccaaacgtctggatcacttcgccgctcacggctgtaaagtgtctgaccacgcg
ctggatgtggtgatgtttgctgaagcgaacgaagcggaactggacagcattctggcgcgc
cgtctggctggcgaaaccctgagcgagcacgaagtggcgcagttcaaaactgcggtactg
gtgttccttggtgccgaatatgcacgtcgcggctgggtacagcagtaccacattggcgcg
ctgcgtaataacaacctgcgtcagttcaaactgctggggccggatgtaggctttgactcc
atcaacgaccgtccgatggcggaagagctgtctaagttgctgagcaagcagaatgaagaa
aacctgctgccgaaaaccattctgtactgcctgaacccgcgcgataacgaagtgctgggc
accatgatcggtaacttccagggcgaaggtatgccgggcaaaatgcagttcggttccggc
tggtggtttaacgatcagaaagacggtatggaacgtcagatgacccaactggcgcagctc
ggtctgctgagccgctttgtcggtatgctgactgacagccgtagcttcctgtcatacacc
cgtcacgaatacttccgccgcattctgtgccagatgatcggtcgctgggtggaagcgggc
gaagcaccggcggacatcaacctgctgggcgagatggtgaaaaatatttgctttaacaat
gcgcgtgactacttcgccattgaactgaactaa
              
                            

Download fasta file
RegulonDB