RegulonDB RegulonDB 10.9: Gene Sequence
yaaI gene sequence


Size: 405        A: 115  T: 92  G: 90  C: 108

Fasta

 

>yaaI E. coli K12. Version NC_000913.3 GI:556503834
atgaaatccgtttttacgatttccgccagcctggcgattagcctgatgctgtgctgcacg
gcgcaggcaaacgaccataaactcctcggcgccattgcaatgccgcgtaacgaaaccaac
gatctggcgctgaaacttcctgtttgtcgcattgtgaaacgcatacaactctctgccgac
catggcgatttacagttaagcggtgcatcggtttatttcaaagccgcccgtagcgccagt
cagagcctgaatattccttcagaaataaaagaagggcaaaccactgactggatcaacatt
aacagcgataacgacaataaacgctgcgtctcaaaaatcaccttttcgggtcatacggtg
aactcatcggatatggccacgctgaaaattatcggcgacgactaa
              
                            

Download fasta file
RegulonDB