RegulonDB RegulonDB 10.9: Gene Sequence
gapC gene sequence


Size: 1001        A: 275  T: 245  G: 248  C: 233

Fasta

 

>gapC E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaagttggtattaacggttttggtcgtatcggtcgactggtgttgggtcgatta
cttgaagtcaaaagcaacatagacgttgtcgctattaatgatctcacttccccataaatt
ctcgcctacctgctgaaacatgattcaaactacggaccattcccctggagcgttgatttt
acggaagattcacttatcgttgatgggaaaagtatcgcggtttacgccgaaaaagaggct
aaaaatattccgtggaaagcgaaaggtgcagaaatcattgtcgaatgtactggcttttat
acctccgccgagaaatcgcaggcgcatcttgatgctggtgcgaagaaggtgttgatttcc
gcccctgccggtgaaatgaaaactatcgtttataacgtcaatgacgacactctggatggc
aacgacaccattgtttccgtggcgtcatgcaccactaactgtcttgcgccgatggccaaa
gccttgcatgacagtttcgggatagaagtcggcacgatgacgaccattcatgcctatact
ggcacccagtcactggtggatggcccgcgtggtaaagatttacgtgcttcacgcgcagcg
gcagaaaatatcattccccacactacgggggcggcaaaagccattggtctggtgatcccg
gaactgagcggcaaactgaaaggtcatgcgcaacgcgtgccggtgaaaacaggttcggtc
actgaactggtatcgattctcggaaaaaagtgactgccgaagaggtgaataacgcactta
aacaagcaaccaccaataacgagtcatttggttataccgatgaagaaatagtctcttccg
atatcattggcagccatttcggttcggtgtttgatgccacgcaaacggaaattaccgccg
tgggcgatttacaactggtgaaaacggtcgcctggtacgataacgaatatggcttcgtca
cacagcttattcgcaccctcgaaaaattcgctaaactctga
              
                            

Download fasta file
RegulonDB