RegulonDB RegulonDB 10.9: Gene Sequence
srlA gene sequence


Size: 564        A: 123  T: 158  G: 138  C: 145

Fasta

 

>srlA E. coli K12. Version NC_000913.3 GI:556503834
atgatagaaaccattactcatggtgcagagtggtttatcgggctgttccaaaagggcgga
gaggtgtttaccgggatggtgaccggcattcttccgctgttgattagcctgctggttatc
atgaacgcactgattaattttatcggtcagcatcgtattgaacgttttgctcaacgttgc
gccggtaaccctgtttcccgttacctactgttaccgtgcattggcacgtttgtcttttgc
aatccgatgaccctaagcctgggtcgctttatgccggaaaagtacaaacccagctactac
gcggcggcctcttatagctgccactcaatgaatggcctcttcccccatatcaaccctggc
gaactgtttgtttatcttggcattgccagcggtctgacaacgctgaacctgccacttggc
ccactggcggtgagttatctgctggttggtctggtcaccaatttcttccgcggctgggtg
accgatctgaccaccgccatttttgagaaaaagatgggcattcaacttgaacaaaaagtt
cacctggcaggagcaacatcatga
              
                            

Download fasta file
RegulonDB