RegulonDB RegulonDB 10.8: Gene Sequence
xapA gene sequence


Size: 834        A: 181  T: 222  G: 239  C: 192

Fasta

 

>xapA E. coli K12. Version NC_000913.3 GI:556503834
atgtctcaggttcaattttctcataacccgctgttttgcatagatattatcaagacttat
aaacctgatttcacgccacgagtggcctttattttaggttccgggctcggcgcgctggcc
gatcagattgagaacgctgtcgcaatttcctacgaaaagctgccgggcttcccggtaagt
acggtacatggtcatgcgggggagttagtgctgggccatctccagggcgtaccggtggta
tgtatgaaaggtcgcggacatttctacgaaggtcgtggaatgaccattatgactgacgca
attcgtacctttaagctgctgggctgcgagctactgttctgcaccaatgcggcaggctcg
ctgcgtccggaagtgggggcaggcagcctggtcgcattgaaagatcatatcaacaccatg
cccggtacgccgatggtgggtcttaacgatgatcgttttggagagcgcttcttctcactg
gcaaatgcctacgatgcggaataccgcgcactgttacaaaaagtggcgaaagaagagggt
ttccctctgacggagggcgtgttcgtctcgtatccggggccgaatttcgagactgcggcg
gaaattcgcatgatgcaaattattggtggggatgttgttggtatgtctgtggtgcctgag
gttatttcagctcgccattgcgaccttaaagtcgttgcggtctctgcgattaccaatatg
gcggaaggtttaagcgatgtgaaattgtcacatgcgcaaacgctggcggctgcggagctc
tctaagcagaacttcatcaaccttatttgtggctttctgcgcaaaattgcctga
              
                            

Download fasta file
RegulonDB