RegulonDB RegulonDB 10.9: Gene Sequence
thiM gene sequence


Size: 789        A: 175  T: 187  G: 222  C: 205

Fasta

 

>thiM E. coli K12. Version NC_000913.3 GI:556503834
atgcaagtcgacctgctgggttcagcgcaatctgcgcacgcgttacacctttttcaccaa
cattcccctcttgtgcactgcatgaccaatgatgtggtgcaaacctttaccgccaatacc
ttgctggcgctcggtgcatcgccagcgatggttatcgaaaccgaagaggccagtcagttt
gcggctatcgccagtgccttgttgattaacgttggcacactgacgcagccacgcgctcag
gcgatgcgtgctgccgttgagcaagcaaaaagctctcaaacaccctggacgcttgatcca
gtagcggtgggtgcgctcgattatcgccgccatttttgtcatgaacttttatcttttaaa
ccggcagcgatacgtggtaatgcttcggaaatcatggcattagctggcattgctaatggc
ggacggggagtggataccactgacgccgcagctaacgcgatacccgctgcacaaacactg
gcacgggaaactggcgcaatcgtcgtggtcactggcgagatggattatgttaccgatgga
catcgtatcattggtattcacggtggtgatccgttaatgaccaaagtggtaggaactggc
tgtgcattatcggcggttgtcgctgcctgctgtgcgttaccaggcgatacgctggaaaat
gtcgcatctgcctgtcactggatgaaacaagccggagaacgcgcagtcgccagaagcgag
gggccaggcagttttgttccacatttccttgatgcgctctggcaattgacgcaggaggtg
caggcatga
              
                            

Download fasta file
RegulonDB