RegulonDB RegulonDB 10.10: Gene Sequence
mhpA gene sequence


Size: 1665        A: 352  T: 364  G: 508  C: 441

Fasta

 

>mhpA E. coli K12. Version NC_000913.3 GI:556503834
atggcaatacaacaccctgacatccagcctgctgttaaccatagcgttcaggtggcgatc
gctggtgccggcccggttgggctgatgatggcgaactatctcggccagatgggcattgac
gtgctggtggtggagaaactcgataagttgatcgactacccgcgtgcgattggtattgat
gacgaggcgctgcgcaccatgcagtcggtcggcctggtcgatgatgttctgccgcacact
acgccgtggcacgcgatgcgttttctcaccccgaaaggccgctgttttgctgatattcag
ccaatgaccgatgaatttggctggccgcgccgtaacgcctttattcagccgcaggtcgat
gcggtgatgctggaaggggtgtcgcgttttccgaatgtgcgctgcttgttttcccgcgag
ctggaggccttcagtcagcaagatgacgaagtgaccttgcacctgaaaacggcagaaggg
cagcgggaaatagtcaaagcccagtggctggtagcctgtgacggtggagcaagttttgtc
cgtcgcactctgaatgtgccgtttgaaggtaaaactgcgccaaatcagtggattgtggta
gatatcgccaacgatccgttaagtacgccgcatatctatttgtgttgcgatccggtgcgc
ccgtatgtttctgccgcgctgcctcatgcggtacgtcgctttgaatttatggtgatgccg
ggagaaaccgaagagcagctgcgtgagccgcaaaatatgcgcaagctgttaagcaaagtg
ctgcctaatccggacaatgttgaattgattcgccagcgtgtctacacccacaacgcgcga
ctggcgcaacgtttccgtattgatcgcgtactgctggcgggcgatgccgcgcacatcatg
ccggtatggcaggggcagggctataacagtggtatgcgcgacgcctttaacctcgcatgg
aaactggcgttggttatccaggggaaagcccgcgatgcgctgctcgatacctatcaacaa
gaacgtcgcgatcacgccaaagcgatgattgacctgtccgtgacggcgggcaacgtgctg
gctccgccgaaacgctggcagggtacgttacgtgacggcgtttcctggctgttgaattat
ctgccgccagtaaaacgctacttcctcgaaatgcgcttcaagccgatgccgcaatattac
ggcggtgcgctgatgcgtgagggcgaagcgaagcactctccggtcggcaagatgtttatt
cagccgaaagtcacgctggaaaacggcgacgtgacgctgctcgataacgcgatcggcgcg
aacttcgcggtaattggctggggatgcaatccactgtgggggatgagcgacgagcaaatc
cagcagtggcgcgcgttgggcacacgcttcattcaggtggtgccggaagtgcaaattcat
accgcacaggataaccacgacggcgtactacgcgtgggcgatacgcaaggtcgcctgcgt
agctggttcgcgcaacacaatgcttcgctggtggtgatgcgcccggatcgctttgttgcc
gccaccgccattccgcaaaccctgggcaagaccctgaataaactggcgtcggtgatgacg
ctgacccgccctgatgccgacgtttctgtcgaaaaggtagcctga
              
                            

Download fasta file
RegulonDB