RegulonDB RegulonDB 10.9: Gene Sequence
mhpB gene sequence


Size: 945        A: 177  T: 222  G: 292  C: 254

Fasta

 

>mhpB E. coli K12. Version NC_000913.3 GI:556503834
atgcacgcttatcttcactgtctttcccactcgccgctggtggggtatgtcgacccggcg
caagaggtgctcgatgaggtcaatggcgtgattgccagcgcccgcgagcgtattgcggca
ttctcccctgaactggtggtgctgtttgcgccagatcactacaacggctttttctatgac
gtgatgccaccgttctgtttaggcgttggagcgacggcaattggtgatttcggcagtgcg
gcaggagagctgcccgtgcctgtggagctggcggaggcctgtgcgcatgccgtcatgaag
agcgggatcgatcttgccgtttcttactgtatgcaggtggaccacgggttcgcccagccg
ctggagttcctgctcggtgggctggataaggtgccagttctgcctgtgttcatcaacggt
gtcgccacgccgctgcccggtttccagcgtacccgcatgttgggtgaagccattggacgt
ttcaccagcactctcaataaacgcgtgctgttcctgggttccggtgggctttcccatcag
ccgccggtgcccgaactggcgaaagccgatgcccatatgcgcgaccgtctgttggggagc
gggaaagatttacccgccagtgagcgcgaattgcgtcagcaacgggtgattagcgccgct
gagaagtttgttgaggatcagagaacgctgcatccgctcaacccgatttgggataaccag
ttcatgactttgctggagcagggacgcatacaggaactggatgccgtcagtaacgaagag
ctttccgccattgccggaaagtcgacacatgaaatcaaaacctgggtcgccgcttttgcc
gctatttctgcgtttggcaactggcgtagcgaagggcgttattaccgcccaatcccggag
tggattgccggatttggctcgttaagcgccagaacagagaactga
              
                            

Download fasta file
RegulonDB