RegulonDB RegulonDB 10.9: Gene Sequence
mhpC gene sequence


Size: 867        A: 189  T: 204  G: 253  C: 221

Fasta

 

>mhpC E. coli K12. Version NC_000913.3 GI:556503834
atgagttatcagccacaaaccgaagccgccaccagccgttttctgaatgtagaagaagcg
ggtaaaacgctgcgcatccattttaatgactgcggacaaggcgacgaaaccgttgtcctg
ctgcatggttccggcccgggtgctactggctgggcgaacttcagccgcaatatcgatccg
ctggtagaggcgggctatcgggtgatcctgctggattgtccgggttggggcaagagcgat
tcggtcgttaatagtggttcgcgatcggatcttaatgcacgaatcctgaaaagcgtggtg
gatcaactggatatcgccaaaatccacctgctgggcaactcgatggggggccatagttct
gtggcgttcacccttaaatggccggagcgcgtcggcaaactggtgctgatgggcggcggt
acgggcggcatgagtttgtttacgccgatgccaaccgaaggtattaagcgactgaatcag
ctttatcgtcagccgactatcgaaaacctgaagctgatgatggatatcttcgtttttgat
accagcgatttgaccgacgccctgtttgaagcgcgcctgaataatatgctgtcgcgccgc
gatcacctggaaaacttcgttaagagcctggaagctaatccgaaacagttcccggatttt
ggcccacgtctggcggaaatcaaagcgcaaaccctgattgtctgggggcgcaacgaccgc
tttgtgccgatggatgcgggtctgcgtctgctgtccggcattgccggttctgaactgcat
atcttccgcgactgtggtcactgggcgcagtgggaacatgccgacgctttcaatcaactg
gtgctgaatttcctcgcacgcccttaa
              
                            

Download fasta file
RegulonDB