RegulonDB RegulonDB 11.0: Gene Sequence
mhpF gene sequence


Size: 951        A: 225  T: 208  G: 278  C: 240

Fasta

 

>mhpF E. coli K12. Version NC_000913.3 GI:556503834
atgagtaagcgtaaagtcgccattatcggttctggcaacattggtaccgatctgatgatt
aaaattttgcgtcacggtcagcatctggagatggcggtgatggttggcattgatcctcag
tccgacggtctggcgcgcgccagacgtatgggcgtcgccaccacccatgaaggggtgatc
ggactgatgaacatgcctgaatttgctgatatcgacattgtatttgatgcgaccagcgcc
ggtgctcatgtgaaaaacgatgccgctttacgcgaagcgaaaccggatattcgcttaatt
gacctgacgcctgctgccatcggcccttactgcgtgccggtggttaacctcgaggcgaac
gtcgatcaactgaacgtcaacatggtcacctgcggcggccaggccaccattccaatggtg
gcggcagtttcacgcgtggcgcgtgttcattacgccgaaattatcgcttctatcgccagt
aaatctgccggacctggcacgcgtgccaatatcgatgaatttacggaaaccacttcccga
gccattgaagtggtgggcggcgcggcaaaagggaaggcgattattgtgcttaacccagca
gagccaccgttgatgatgcgtgacacggtgtatgtattgagcgacgaagcttcacaagat
gatatcgaagcctcaatcaatgaaatggctgaggcggtgcaggcttacgtaccgggttat
cgcctgaaacagcgcgtgcagtttgaagttatcccgcaggataaaccggtcaatttaccg
ggcgtggggcaattctccggactgaaaacagcggtctggctggaagtcgaaggcgcagcg
cattatctgcctgcctatgcgggcaacctcgacattatgacttccagtgcgctggcgaca
gcggaaaaaatggcccagtcactggcgcgcaaggcaggagaagcggcatga
              
                            

Download fasta file
RegulonDB