RegulonDB RegulonDB 10.9: Gene Sequence
ruvA gene sequence


Size: 612        A: 156  T: 130  G: 173  C: 153

Fasta

 

>ruvA E. coli K12. Version NC_000913.3 GI:556503834
gtgataggcagactcagaggcatcatcattgaaaaacaacccccgctggtgttaattgaa
gtgggcggcgtaggctatgaagtgcatatgccgatgacctgtttttatgaactccctgaa
gcgggtcaggaagcgatcgttttcacccactttgtggtgcgtgaagacgcgcaactgctg
tacggttttaacaataaacaagagcgcacattgttcaaagagttgatcaaaaccaacggc
gtcggcccgaagttggcgctggcgatcctctccggaatgtcagcgcagcagttcgttaat
gccgttgagcgtgaagaagtgggggcactggtgaaactgccgggtattggcaaaaaaacc
gccgaacgcttgattgttgaaatgaaagaccgatttaaaggtttgcatggcgatctcttt
acgccagccgccgacctggtactcacgtctcctgccagcccggcgaccgacgatgctgaa
caagaagcggttgccgcgctggtggcgctgggctataaaccacaagaagcaagccgcatg
gtgagcaaaatcgctcgccctgacgccagcagtgaaactttaattcgcgaagccctacgc
gccgcgttatga
              
                            

Download fasta file
RegulonDB