RegulonDB RegulonDB 10.9: Gene Sequence
ruvB gene sequence


Size: 1011        A: 218  T: 260  G: 294  C: 239

Fasta

 

>ruvB E. coli K12. Version NC_000913.3 GI:556503834
atgattgaagcagaccgtctgatttctgccggtaccactttgccggaagatgtagcagat
cgcgccattcgccccaaattactggaagagtatgttggtcagccgcaggttcgttcacag
atggagattttcatcaaagcagcgaaactgcgcggcgatgccctcgatcatttgttgatt
tttggtcctccggggttgggtaaaactacgcttgccaacattgtcgccaatgaaatgggc
gttaatttacgcacgacttctggtccggtgctggaaaaggcgggcgatttggctgcgatg
ctcactaaccttgaaccgcatgacgtgctgtttattgatgagatccaccgtctatcgcca
gttgttgaagaagtgctgtacccggcaatggaagactaccaactggatatcatgattggt
gaaggtccggcggcacgctccattaaaattgatttgccgccgtttaccctgattggtgca
accacgcgcgcaggttcgctgacatcaccgttgcgcgaccgttttggtattgtgcaacgt
ctggagttttatcaggtgccggatctgcaatatatcgtcagtcgcagcgcacgctttatg
gggcttgagatgagtgatgacggcgcgctggaagttgctcgtcgcgctcgcggtacgccg
cgcattgccaaccgtctgctgcgtcgagtgcgtgatttcgccgaagtgaagcacgatggc
accatctcggcagatatcgctgctcaggcgctggatatgttgaatgtcgatgctgaaggt
ttcgattatatggaccgcaaattgttgctggcggtaatcgataagttctttggtggacct
gtaggtctggataacctggcggcagccattggcgaagaacgtgaaaccattgaggatgtg
ctggaaccttatttgattcagcaaggctttttgcagcgtacaccgcgtgggcgtatggcg
acgacgcgggcgtggaatcactttggcataacgccgccagaaatgccgtaa
              
                            

Download fasta file
RegulonDB