RegulonDB RegulonDB 10.9: Gene Sequence
ymgF gene sequence


Size: 219        A: 63  T: 68  G: 42  C: 46

Fasta

 

>ymgF E. coli K12. Version NC_000913.3 GI:556503834
atgaacaatagtaataatctggattatttcactctctatatcatattttccattgcattt
atgctgatcaccctcctggtcatccttattgcaaaacccagtaccgggctgggagaagtg
cttgtgacgataaatttgcttaatgcccttgtttggctggcgatcaatctggttaatcga
ttaagagaaagactcgtcaaccacagggatcagcaataa
              
                            

Download fasta file
RegulonDB