RegulonDB RegulonDB 10.9: Gene Sequence
yhiM gene sequence


Size: 1053        A: 218  T: 339  G: 256  C: 240

Fasta

 

>yhiM E. coli K12. Version NC_000913.3 GI:556503834
gtgaacatatatatcgggtggcttttcaaattaatccctttgattatgggcttaatttgt
atcgcgttaggtggctttgtgctggaaagttcagggcaaagcgagtatttcgtcgcgggt
catgtgctgatttctctggcggccatatgcctggcattattcactaccgcatttattatc
atttcgcagctcacgcgcggcgttaatacgttttacaatacattgttccccattattggc
tatgcggggtcaattatcaccatgatatggggttgggcactgttagcaggcaatgatgtg
atggcagacgagtttgtcgccggccatgttattttcggcgttggtatgattgccgcctgt
gtatcgacggtggcagcgtcatccggtcactttctgctcattcccaaaaatgcagcgggg
agcaagagcgacggaacaccggtacaggcttattcttcattaatcggtaactgcctcatt
gccgttcccgttttactcaccctgctcggtttcatttggtctattacgctgttacgtagt
gctgacataactccgcattatgtcgcgggtcacgtattgcttgggttaaccgcaatctgt
gcctgtctaattggccttgttgccacaattgtccatcaaacacgtaatacgttttcaact
aaagaacactggctgtggtgttattgggttatttttctcggctcaatcacggtactgcag
gggatatacgtcttagtcagttccgatgcaagcgcccgactggctcccggcattattctt
atttgcctcggaatgatctgttacagcatattctcaaaagtctggctactggcactggta
tggagacgtacctgttcgttagccaacagaataccgatgattcccgtcttcacctgcctg
ttttgccttttcctggcatcgtttcttgcggaaatggcgcagaccgacatgggatatttt
attccttcgcgagttctggtcggtttgggagcggtatgctttacgttgttctcaatcgtt
tcaatattagaagcgggttctgctaaaaaataa
              
                            

Download fasta file
RegulonDB