RegulonDB RegulonDB 10.9: Gene Sequence
ykfH gene sequence


Size: 222        A: 56  T: 42  G: 56  C: 68

Fasta

 

>ykfH E. coli K12. Version NC_000913.3 GI:556503834
atgaaaattatcagtaaacgcagggcaatgacgatataccgccagcatcctgagtcccga
atctttcgctactgcaccggcaaataccagtggcacggtagcgtctgtcattacaccggc
agggacgttccggatatcgccggagtcctcgcggtatacgccgaacgccgccaggaccgc
aatgggccctatacctgcctgatgagcatcaccctgaactga
              
                            

Download fasta file
RegulonDB