RegulonDB RegulonDB 10.9: Gene Sequence
insX gene sequence


Size: 249        A: 76  T: 56  G: 58  C: 59

Fasta

 

>insX E. coli K12. Version NC_000913.3 GI:556503834
atgagcggtaagcgttatcccgaagagtttaaaactgaagcagtcaaacaggttgttgat
ctcggttattctgttgccagcgttgcaacacgtctcgatatcaccacccacagcctttat
gcctggataaagaagtacggtccggattcttccactaataaagaacagtcagatgctcag
gccgagatccgccgtctccagaaagagctgaaacgggttaccgacgaacgggacatatta
aaaaaagct
              
                            

Download fasta file
RegulonDB