RegulonDB RegulonDB 10.9: Gene Sequence
ykgO gene sequence


Size: 141        A: 46  T: 36  G: 32  C: 27

Fasta

 

>ykgO E. coli K12. Version NC_000913.3 GI:556503834
atgaaagttcttaactctctgcgtaccgcaaaagaacgccatccagactgtcagattgtg
aagcgaaaaggacggctatatgtgatttgtaaatctaatccacgttttaaggccgttcag
ggtcgtaagaaaaaacgttga
              
                            

Download fasta file
RegulonDB