RegulonDB RegulonDB 10.8: Gene Sequence
rzoD gene sequence


Size: 183        A: 41  T: 38  G: 53  C: 51

Fasta

 

>rzoD E. coli K12. Version NC_000913.3 GI:556503834
atgcgaaagctgaaaatgatgctctgcgtgatgatgttgccgctggtcgtcgtcggttgc
acatcaaagcagtctgtcagtcagtgcgtgaagccaccacggcctccggcgtggataatg
cagcctccccccgactggcagacaccgctgaacgggattatttcaccctcagagagaggc
tga
              
                            

Download fasta file
RegulonDB