RegulonDB RegulonDB 10.9: Gene Sequence
ybdZ gene sequence


Size: 219        A: 49  T: 48  G: 63  C: 59

Fasta

 

>ybdZ E. coli K12. Version NC_000913.3 GI:556503834
atggcattcagtaatcccttcgatgatccgcagggagcgttttacatattgcgcaatgcg
caggggcaattcagtctgtggccgcaacaatgcgtcttaccggcaggctgggacattgtg
tgtcagccgcagtcacaggcgtcctgccagcagtggctggaagcccactggcgtactctg
acaccgacgaattttacccagttgcaggaggcacaatga
              
                            

Download fasta file
RegulonDB