RegulonDB RegulonDB 10.10: Gene Sequence
ybdD gene sequence


Size: 198        A: 52  T: 43  G: 58  C: 45

Fasta

 

>ybdD E. coli K12. Version NC_000913.3 GI:556503834
atgtttgattcactggcaaaagccggaaaatatttaggtcaggcggcgaagctgatgatt
ggtatgcctgattacgacaactatgtcgaacatatgcgggttaaccatcccgatcaaacg
ccgatgacctacgaagagtttttccgtgagcggcaggacgcgcgctacggtggaaaaggc
ggcgcgcgctgctgctaa
              
                            

Download fasta file
RegulonDB