RegulonDB RegulonDB 10.10: Gene Sequence
kdpF gene sequence


Size: 90        A: 15  T: 31  G: 29  C: 15

Fasta

 

>kdpF E. coli K12. Version NC_000913.3 GI:556503834
gtgagtgcaggcgtgataaccggcgtattgctggtgtttttattactgggttatctggtt
tatgccctgatcaatgcggaggcgttctga
              
                            

Download fasta file
RegulonDB