RegulonDB RegulonDB 10.9: Gene Sequence
ybfQ gene sequence


Size: 255        A: 79  T: 79  G: 58  C: 39

Fasta

 

>ybfQ E. coli K12. Version NC_000913.3 GI:556503834
atggaacttaaaaaattgatggaacatatttctattacacccgattacagacaagcctgg
aaagtggtgcataaattgtcagatattctactgttgactatttgtgccgttatttctggt
gcagaaggttgggaagatatagaggatttcggggaaacacatctcgattttttgaagcaa
tatggtgattttgaaaatggtattcctgttcacgataccattgccagagttgtatcccag
ggaaagatcacgtaa
              
                            

Download fasta file
RegulonDB