RegulonDB RegulonDB 10.9: Gene Sequence
cydX gene sequence


Size: 114        A: 25  T: 30  G: 33  C: 26

Fasta

 

>cydX E. coli K12. Version NC_000913.3 GI:556503834
atgtggtatttcgcatggattctgggaacgcttcttgcctgttcgtttggggtaatcacc
gcgctggcgcttgaacacgtcgaatcaggcaaagccggtcaagaagacatctga
              
                            

Download fasta file
RegulonDB