RegulonDB RegulonDB 10.10: Gene Sequence
ymdF gene sequence


Size: 174        A: 62  T: 23  G: 53  C: 36

Fasta

 

>ymdF E. coli K12. Version NC_000913.3 GI:556503834
atggcaaaccatcgaggcggttccggcaattttgcagaagaccgcgaaagagcatcagaa
gcaggtaaaaaaggtggacagcacagcgggggtaatttcaagaatgacccgcagcgcgca
tctgaagcaggtaaaaaaggtggtaagagcagtcacggcaaaagcgacaactag
              
                            

Download fasta file
RegulonDB