RegulonDB RegulonDB 10.8: Gene Sequence
ycgI gene sequence


Size: 344        A: 87  T: 84  G: 106  C: 67

Fasta

 

>ycgI E. coli K12. Version NC_000913.3 GI:556503834
tatcatttatccaatggcatggaatcgaaatcagtcgatacccgcagtatatatcgtgaa
ctgggtgcaacgctgagttacaacatgcgcctggggaacggtatggaaatgaaccctggc
tgaaggcggctgtgcgcaaagaatttgtcgatgataaccgggtgaaggtgaataatgacg
gtaatttcgtcaatgatttgtcgggcagacgtggaatataccaggcagctattaaagcct
cattcagcagtacgtttagcggacatctcggggtggggtatagccatggtgccggtgtgg
aatccccgtggaacgcggtggctggtgtgaactggtcgttctga
              
                            

Download fasta file
RegulonDB