RegulonDB RegulonDB 10.9: Gene Sequence
ymjB gene sequence


Size: 114        A: 36  T: 36  G: 25  C: 17

Fasta

 

>ymjB E. coli K12. Version NC_000913.3 GI:556503834
gtggtccgtgctggtgcgttaaatgattatcatgcaggagaaaatatcactattcatttt
gatatgacgaaatgtcatttctttgatgcagaaacggaaatagcaattcgctaa
              
                            

Download fasta file
RegulonDB