RegulonDB RegulonDB 10.8: Gene Sequence
ymjC gene sequence


Size: 183        A: 70  T: 40  G: 31  C: 42

Fasta

 

>ymjC E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaatgtactgattcttggtgctggcggtcagatagcccgccatgtgattaatcaa
ctggcagataagcaaaccattaaacaaactttatttgcccgtcagccagcaaaaatccac
aaaccctatccaactaataaaatgcaaacaacttccggcaaaaaagtgatacaagatcga
tga
              
                            

Download fasta file
RegulonDB