RegulonDB RegulonDB 10.8: Gene Sequence
ydaF gene sequence


Size: 156        A: 52  T: 27  G: 37  C: 40

Fasta

 

>ydaF E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaaaatcgacctcggcaacaacgaatccctggtgtgcggcgtgttccccaaccag
gatggaacgttcactgccatgacgtataccaaaagcaaaacatttaaaaccgaaactggt
gcgcgccgatggttggagaagcacacagtaagctaa
              
                            

Download fasta file
RegulonDB