RegulonDB RegulonDB 10.9: Gene Sequence
rzoR gene sequence


Size: 186        A: 41  T: 39  G: 52  C: 54

Fasta

 

>rzoR E. coli K12. Version NC_000913.3 GI:556503834
atgcgaaagctgaaaatgatgctctgcgtgatgatgttgccgctggtcgtcgtcggttgc
acatcaaagcagtctgtcagtcagtgcgtgaagccaccaccgcctccggcgtggataatg
cagcctccccccgactggcagacaccgctgaacgggattatttcaccctccgggaacgac
tggtaa
              
                            

Download fasta file
RegulonDB