RegulonDB RegulonDB 10.9: Gene Sequence
ydbJ gene sequence


Size: 267        A: 54  T: 67  G: 87  C: 59

Fasta

 

>ydbJ E. coli K12. Version NC_000913.3 GI:556503834
atgcgagcagcgttttgggtagggtgtgccgctttattgttgtcggcgtgtagtagtgaa
cctgttcagcaggcgactgccgcgcacgtagcgccaggtttaaaagcgtcgatgtccagt
agtggagaagcaaattgtgcaatgatcggcggttcgctttctgttgcccgtcaactggat
ggtacggcgattgggatgtgtgcattacccaacggcaaacgctgtagcgaacagtcactt
gccgccgggagctgtggcagctattaa
              
                            

Download fasta file
RegulonDB