RegulonDB RegulonDB 10.9: Gene Sequence
yniD gene sequence


Size: 108        A: 26  T: 30  G: 34  C: 18

Fasta

 

>yniD E. coli K12. Version NC_000913.3 GI:556503834
atgccgactaaacgctttgataaaaaacactggaagatggtggtggtgctactggcaatc
tgtggcgctatgttgttgctacgttgggcagcaatgatttggggctga
              
                            

Download fasta file
RegulonDB