RegulonDB RegulonDB 11.0: Gene Sequence
yobH gene sequence


Size: 240        A: 69  T: 66  G: 61  C: 44

Fasta

 

>yobH E. coli K12. Version NC_000913.3 GI:556503834
atgcgattcatcattcgcacagttatgctgatagcactggtatggataggattattactc
agcggatatggcgttttgattggaagcaaagagaatgccgcaggattaggtttgcaatgt
acctatctgactgccagaggcaccagcacggtacaatacttgcacactaaaagtggtttt
ttggggataacagattgcccgctgttacgcaaaagcaatatcgtggtcgataatggttaa
              
                            

Download fasta file
RegulonDB