RegulonDB RegulonDB 11.1: Gene Sequence
arnE gene sequence


Size: 336        A: 61  T: 95  G: 106  C: 74

Fasta

 

>arnE E. coli K12. Version NC_000913.3 GI:556503834
atgatctggctaacattagtctttgccagcttgcttagcgttgccgggcagttgtgtcag
aaacaggcaacctgctttgtggcgataaacaaacggcgcaaacatatcgtgctgtggctg
ggactggcgctggcttgtcttggtcttgccatggtgctctggctgctggtcttgcagaac
gtaccggtaggcattgcttacccgatgttaagtctgaattttgtctgggtgacgctggct
gcagtaaaactgtggcacgaaccggtatcgccgcgtcactggtgtggggtggcgttcatt
attggcggcattgtgatcctcgggagtacggtgtaa
              
                            

Download fasta file
RegulonDB