RegulonDB RegulonDB 10.9: Gene Sequence
ypdJ gene sequence


Size: 141        A: 43  T: 37  G: 30  C: 31

Fasta

 

>ypdJ E. coli K12. Version NC_000913.3 GI:556503834
atgggatatgactctcggttggatcatctggcagcaacgagctggtatccatttttcaac
aatgtcacaacaagaggtgaaataatagagccatacagcctcacactcgatgaggcctgt
cagtttcttaaaatatcctga
              
                            

Download fasta file
RegulonDB