RegulonDB RegulonDB 10.9: Gene Sequence
ypfN gene sequence


Size: 201        A: 56  T: 48  G: 54  C: 43

Fasta

 

>ypfN E. coli K12. Version NC_000913.3 GI:556503834
atggactggctggctaaatattggtggattctggtgattgtctttttggtaggcgtcctg
ctgaacgtgattaaagatctcaagcgcgtcgaccataagaaatttctcgccaacaagccg
gagcttcccccgcatcgtgatttcaacgataagtgggacgatgacgacgactggccgaaa
aaggatcaaccgaagaagtaa
              
                            

Download fasta file
RegulonDB