RegulonDB RegulonDB 10.9: Gene Sequence
yeiW gene sequence


Size: 255        A: 56  T: 57  G: 65  C: 77

Fasta

 

>yeiW E. coli K12. Version NC_000913.3 GI:556503834
atggaatgccgtccgggttgcggggcgtgttgcactgccccttcaatttccagccctatt
cccggtatgccagatggcaagcccgccaatacgccctgcattcagcttgatgaacagcaa
cgctgtaaaattttcacctcgccactgcgaccgaaagtctgtgcaggcttacaagccagc
gctgaaatgtgcggtaactcgcgtcagcaggccatgacctggcttatcgatctggaaatg
ctgaccgcgccttaa
              
                            

Download fasta file
RegulonDB