RegulonDB RegulonDB 10.9: Gene Sequence
ymiA gene sequence


Size: 141        A: 30  T: 42  G: 41  C: 28

Fasta

 

>ymiA E. coli K12. Version NC_000913.3 GI:556503834
atgaggttagcaatgccttctggaaatcaggaaccccgccgcgatcctgaattaaaacgt
aaagcctggctggcggtttttcttggttctgcacttttctgggtggttgtcgcactgctg
atttggaaagtgtggggataa
              
                            

Download fasta file
RegulonDB