RegulonDB RegulonDB 10.9: Gene Sequence
insEF3 gene sequence


Size: 1163        A: 295  T: 241  G: 328  C: 299

Fasta

 

>insEF-3 E. coli K12. Version NC_000913.3 GI:556503834
atgacaaaaacagtatcaaccagtaaaaaaccccgtaaacagcattcgcctgaatttcgc
agtgaagccctgaagcttgctgaacgcatcggtgttactgccgcagcccgtgaactcagc
ctgtatgaatcacaactctacaactggcgcagtaaacagcaaaatcagcagacgtcttct
gaacgtgaactggagatgtctaccgagattgcacgtctcaaacgccagctggcagaacgg
gatgaagagctggctatcctccaaaaggccgcgacatacttcgcgaagcgcctgaaatga
agtatgtctttattgaaaaacatcaggctgagttcagcatcaaagcaatgtgccgcgtgc
tccgggtggcccgcagcggctggtatacgtggtgtcagcggcggacaaggataagcacgc
gtcagcagttccgccaacactgcgacagcgttgtcctcgcggcttttacccggtcaaaac
agcgttacggtgccccacgcctgacggatgaactgcgtgctcagggttacccctttaacg
taaaaaccgtggcggcaagcctgcgccgtcagggactgagggcaaaggcctcccggaagt
tcagcccggtcagctaccgcgcacacggcctgcctgtgtcagaaaatctgttggagcagg
atttttacgccagtggcccgaaccagaagtgggcaggagacatcacgtacttacgtacag
atgaaggctggctgtatctggcagtggtcattgacctgtggtcacgtgccgttattggct
ggtcaatgtcgccacgcatgacggcgcaactggcctgcgatgccctgcagatggcgctgt
ggcggcgtaagaggccccggaacgttatcgttcacacggaccgtggaggccagtactgtt
cagcagattatcaggcgcaactgaagcggcataatctgcgtggaagtatgagcgcaaaag
gttgctgctacgataatgcctgcgtggaaagcttctttcattcgctgaaagtggaatgta
tccatggagaacactttatcagccgggaaataatgcgggcaacggtgtttaattatatcg
aatgtgattacaatcggtggcggcggcacagttggtgtggcggcctcagtccggaacaat
ttgaaaacaagaacctcgcttag
              
                            

Download fasta file
RegulonDB