RegulonDB RegulonDB 10.10: Gene Sequence
insAB4 gene sequence


Size: 698        A: 165  T: 155  G: 196  C: 182

Fasta

 

>insAB-4 E. coli K12. Version NC_000913.3 GI:556503834
gtggcttctgtttctatcagctgtccctcctgttcagctactgacggggtggtgcgtaac
ggcaaaagcactgccggacatcagcgctatctctgctctcactgccgtaaaacatggcaa
ctgcagttcacttacaccgcttctcaacccggtacgcaccagaaaatcattgatatggcc
atgaatggcgttggatgccgggcaacagcccgcattatgggcgttggcctcaacacgatt
ttccgccatttaaaaaactcaggccgcagtcggtaacctcgcgcatacagccgggcagtg
acgtcatcgtctgcgcggaaatggacgaacagtggggatacgtcggggctaaatcgcgcc
agcgctggctgttttacgcgtatgacaggctccggaagacggttgttgcgcacgtattcg
gtgaacgcactatggcgacgctggggcgtcttatgagcctgctgtcaccctttgacgtgg
tgatatggatgacggatggctggccgctgtatgaatcccgcctgaagggaaagctgcacg
taatcagcaagcgatatacgcagcgaattgagcggtataacctgaatctgaggcagcacc
tggcacggctgggacggaagtcgctgtcgttctcaaaatcggtggagctgcatgacaaag
tcatcgggcattatctgaacataaaacactatcaataa
              
                            

Download fasta file
RegulonDB