RegulonDB RegulonDB 10.9: Gene Sequence
insAB2 gene sequence


Size: 698        A: 165  T: 153  G: 196  C: 184

Fasta

 

>insAB-2 E. coli K12. Version NC_000913.3 GI:556503834
gtggcttctgtttctatcagctgtccctcctgttcagctactgacggggtggtgcgtaac
ggcaaaagcactgccggacatcagcgctatctctgctctcactgccgtaaaacatggcaa
ctgcagttcacttacaccgcttctcaacccggtacgcaccagaaaatcattgatatggcc
atgaatggcgttggatgccgggcaaccgcccgcattatgggcgttggcctcaacacgatt
ttccgccatttaaaaaactcaggccgcagtcggtaacctcgcgcatacagccgggcagtg
acgtcatcgtctgcgcggaaatggacgaacagtggggatacgtcggggctaaatcgcgcc
agcgctggctgttttacgcgtatgacaggctccggaagacggttgttgcgcacgtattcg
gtgaacgcactatggcgacgctggggcgtcttatgagcctgctgtcaccctttgacgtgg
tgatatggatgacggatggctggccgctgtatgaatcccgcctgaagggaaagctgcacg
taatcagcaagcgatatacgcagcgaattgagcggcataacctgaatctgaggcagcacc
tggcacggctgggacggaagtcgctgtcgttctcaaaatcggtggagcagcatgacaaag
tcatcgggcattatctgaacataaaacactatcaataa
              
                            

Download fasta file
RegulonDB