RegulonDB RegulonDB 10.9: Gene Sequence
insCD1 gene sequence


Size: 1229        A: 306  T: 257  G: 371  C: 295

Fasta

 

>insCD-1 E. coli K12. Version NC_000913.3 GI:556503834
atgattgatgtcttagggccggagaaacgcagacggcgtaccacacaggaaaagatcgca
attgttcagcagagctttgaaccggggatgacggtctccctcgttgcccggcaacatggt
gtagcagccagccagttatttctctggcgtaagcaataccaggaaggaagtcttactgct
gtcgccgccggagaacaggttgttcctgcctctgaacttgctgccgccatgaagcagatt
aaagaactccagcgcctgctcggcaagaaaacgatggaaaatgaactcctcaaagaagcc
gttgaatatggacgggcaaaaaagtggatagcgcacgcgcccttattgcccggggatggg
gagtaagcttagtcagccgttgtctccgggtgtcgcgtgcgcagttgcacgtcattctca
gacgaaccgatgactggatggatggccgccgcagtcgtcacactgatgatacggatgtgc
ttctccgtatacaccatgttatcggagagctgccaacgtatggttatcgtcgggtatggg
cgctgcttcgcagacaggcagaacttgatggtatgcctgcgatcaatgccaaacgtgttt
accggatcatgcgccagaatgcgctgttgcttgagcgaaaacctgctgtaccgccatcga
aacgggcacatacaggcagagtggccgtgaaagaaagcaatcagcgatggtgctctgacg
ggttcgagttctgctgtgataacggagagagactgcgtgtcacgttcgcgctggactgct
gtgatcgtgaggcactgcactgggcggtcactaccggcggcttcaacagtgaaacagtac
aggacgtcatgctgggagcggtggaacgccgcttcggcaacgatcttccgtcgtctccag
tggagtggctgacggataatggttcatgctaccgggctaatgaaacacgccagttcgccc
ggatgttgggacttgaaccgaagaacacggcggtgcggagtccggagagtaacggaatag
cagagagcttcgtgaaaacgataaagcgtgactacatcagtatcatgcccaaaccagacg
ggttaacggcagcaaagaaccttgcagaggcgttcgagcattataacgaatggcatccgc
atagtgcgctgggttatcgctcgccacgggaatatctgcggcagcgggcttgtaatgggt
taagtgataacagatgtctggaaatatag
              
                            

Download fasta file
RegulonDB